BIOLOGY HELP- NEED ASAP no later than tomorrow

1.    Express 0.1324 in scientific notation.
Answer: 1.324⋅10−1
In order to write number 0.1324 in scientific notation we need to move the decimal point from its current location (black dot) to the new position (red dot).
0.1.324
So, you need to move decimal point 1 places to the left.
This means that the power of 10 will be negative 1.
Now we have that the
Number part = 1.324 and
Exponent part = -1

2.    What is the concentration of a 0.01mM solution in terms of molarity. Show your work.

3.    What is the definition of a dependent variable.

4.    If a HCL solution has a concentration of 0.1uM, what is the pH? Show your work.

5.    Detail the steps involved to make one liter of a 1.5M solution of acetic acid CH3COOH.

6.    If a 0.001M solution of HCl is diluted by a factor of 100, what is its resulting pH? Show your work.

7.    What is meant by the term adaption in reference to evolution?

8.    Explain the four subfactors that aid in the tertiary structure of a protein.

9.    What is meant by optimal pH of an enzyme?

10.    How are starch and cellulose different with regard to structure and function.

11.    Draw the structural formula and label two amino acids.

12.    Circle and label the functional groups on the second amino acid.

13.    Write the reaction that would have a dipeptide as a product. Include the reactants as well as the products.

14.    Identify any protein specific bonds formed by the above reaction.

15.    Draw the structural formula and label two different carbohydrates.

16.    Circle and label the functional groups on the first carbohydrate.

17.    Write the reaction that would have a disaccharide as a product. Include speficis reactants as well as the specific products.

18.    Identify any carbohydrate specific bonds formed by the above reaction.

19.    Draw the structural formula of an aldose sugar and circle the aldehyde.

Discuss the steps involved in the replication of the following DNA segment:
5 ATCAGTGCCTGACGCAT3
3 TAGTCACGGACTGCGTA 5

20.    _________________ is the name of the enzyme that begins action on the double alpha helix structure of DNA.

21.    Its acts by:

22.    The enzyme topoisomerase will then act on the DNA to yield a leading and lagging strand.
The     TOP / BOTTOM (circle one) is the leading strand. How do you know for sure?

23.    RNA nucleotides are involved in the replication process.
______________________ and ________________________  are the enzymes used to accomplish this task?

24.    What RNA sequence will result on the lagging strand?

Discuss the steps involved in the expression of this Eukaryotic DNA segment that codes for a short chain protein and contains an intron of five A’s or five T’s in a row.
3’ promotor TACTCACGTTTTTGACTGCCCTA 5’
5’ promotor ATGAGTGCAAAAACTGACGGGAT 3’

25.    What is the name of the enzyme that begins the actual transcription process of the DNA sequence? (Note that you have the DNA in ladder formation, without protein coating, and no hydrogen bonds between nitrogenous bases)

26.    What is the pre mRNA sequence that would be coded by the above DNA.

27.    Label what would be considered the Operons and Introns in the sequence you just wrote.

28.    What is meant by gene splicing?

29.    What is the final mRNA sequence that would be coded by the above DNA?
30.    SEE ATTACHMENT

31.    How is energy involved in the translation process?

32.    What other factors (operative word FACTOR) are involved in the translation process?

33.    What specific chemical process/reaction is a ribosome performing during the translation process?

34.    What is the primary structure of the expressed protein from the gene we have been working with?

35.    What is the chemical structure of this protein?