Your company just purchased a Dell server MD1420 DAS to use to store databases. the databases will contain all employee records and personal identified information (PII). You know that databases like this are often targets. The Chief Information Officer has asked you draft a diagram for the server and 3 connected workstations. The diagram must use proper UML icons.

 When  law enforcement becomes involved, the need may arise to freeze systems  as part of the evidence. There is also the likelihood that the incident  will become known publicly. Do you think these issues play a significant  part in the decision to involve law enforcement? Why or why not? Can  you name some situations in which you believe that large organizations  have decided not to […]

A murder in a downtown office building has been widely publicized. You’re a police detective and receive a phone call from a computer forensics investigator employed by the police department. His name is Gary Owens, and he says he has information that might relate to the murder case. Gary says he ran across a few files while investigating another case at a company in the […]

1.  A piece of DNA sequence is: String DNA = “ACGGGAGGACGGGAAAATTTACTAGC”; Please write one or two statements to generate a reverse complement strand of the DNA sequence and assign it to a String variable rev_com. You should use classes in the biojava package, no import declarations are needed.  2   Write a method that could be called to concatenate any number of DNA sequences passed […]

Part A: Your systems analysis team is close to completing a system for Meecham Feeds. Roger is quite confident that the programs that he has written for Meecham’s inventory system will perform as necessary, because they are similar to programs he has done before. Your team has been very busy and would ideally like to begin full systems testing as soon as possible. 

The following program uses a loop and calls a function called firstFunction() five times, each time passing an argument that is the value of the counter..  Each time it calls the function, a new message is printed. Then firstFunction() calls secondFunction(), without arguments.  When control returns to main(), main() calls thirdFunction(). Again, we prototype both functions.

 Find a readily available sentiment text data set (see Technology Insights 7.2 (page 329) in your textbook(attached document) for a list of popular data sets) and download it into your computer. If you have an analytics tool that is capable of text mining, use that; if not, download RapidMiner (rapid-i.com) and install it. Also install the text analytics add-on for RapidMiner. Process the downloaded data […]

The Case Study presents Mark’s 3D printing business and explains how he wants to expand his operation with more IT infrastructure and additional employees. He has asked you to help him better understand what he currently has and what he will need to create the business he envisions. You realize that although he already has several hardware and network components in use, he really does […]

This assignment consists of two (2) sections: a business requirements document and a Gantt chart or project plan. You must submit both sections as separate files for the completion of this assignment. Label each file name according to the section of the assignment for which it is written. Additionally, you may create and / or assume all necessary assumptions needed for the completion of this […]

The reading this week discusses strategy and how ERM can be integrated with an organization’s overall strategy. Prepare a research paper on some of the various issues, protocols, methods, frameworks you found and discuss how – if possible – organizations can use ERM as strategy. It is perfectly acceptable if you deem ERM cannot be used as strategy, just back up your claim with scholarly […]