Computer science code

Save Time On Research and Writing
Hire a Pro to Write You a 100% Plagiarism-Free Paper.
Get My Paper

1.  A piece of DNA sequence is: String DNA = “ACGGGAGGACGGGAAAATTTACTAGC”; Please write one or two statements to generate a reverse complement strand of the DNA sequence and assign it to a String variable rev_com. You should use classes in the biojava package, no import declarations are needed.  2   Write a method that could be called to concatenate any number of DNA sequences passed in as arguments, and return the concatenated DNA sequence. Two examples of calling the method are shown below:  String DNA1 = dna.concat_DNAs(“ATGC”, “CGTA”);  String DNA2 = dna.concat_DNAs(“AAAA”, “TTTT”, “GGGG”, “CCCC”); 3. Below is the title line of a Blast sequence search hit, please use a method of the String class to extract the GenBank accession number and assign it to a variable called Acc_num.  String title = “>ref|NM_001081660.1| Rattus norvegicus crystallin, gamma B (mapped) (Crygb), mRNA”; 4. Write a Java program that uses a loop to prompt a user to input a clone ID and a DNA sequence. Include an if statement to exit the loop if the user entered the word “exit”. After the user entered an ID and the sequence, save them in a file in a FASTA format (header line starts with a > and followed by the clone id, and the sequences are in the subsequent lines). When the user entered “exit”, print out all the entered sequences to the screen in a FASTA format. 5. Write a program to open a text file (java.txt), and count how many words are in the file. A word is considered character(s) flanked by spaces, and it is not necessary to strip off the punctuation characters. The file name should be given as an argument to the program. Print a message to the screen to indicate how many words the file contains.  Also, print out a sorted list of unique words followed by the number of occurrences of each word in the text.

Place your order
(550 words)

Approximate price: $22

Calculate the price of your order

550 words
We'll send you the first draft for approval by September 11, 2018 at 10:52 AM
Total price:
$26
The price is based on these factors:
Academic level
Number of pages
Urgency
Basic features
  • Free title page and bibliography
  • Unlimited revisions
  • Plagiarism-free guarantee
  • Money-back guarantee
  • 24/7 support
On-demand options
  • Writer’s samples
  • Part-by-part delivery
  • Overnight delivery
  • Copies of used sources
  • Expert Proofreading
Paper format
  • 275 words per page
  • 12 pt Arial/Times New Roman
  • Double line spacing
  • Any citation style (APA, MLA, Chicago/Turabian, Harvard)

Our Guarantees

Delivering a high-quality product at a reasonable price is not enough anymore.
That’s why we have developed 5 beneficial guarantees that will make your experience with our service enjoyable, easy, and safe.

Money-back guarantee

You have to be 100% sure of the quality of your product to give a money-back guarantee. This describes us perfectly. Make sure that this guarantee is totally transparent.

Read more

Zero-plagiarism guarantee

Each paper is composed from scratch, according to your instructions. It is then checked by our plagiarism-detection software. There is no gap where plagiarism could squeeze in.

Read more

Free-revision policy

Thanks to our free revisions, there is no way for you to be unsatisfied. We will work on your paper until you are completely happy with the result.

Read more

Privacy policy

Your email is safe, as we store it according to international data protection rules. Your bank details are secure, as we use only reliable payment systems.

Read more

Fair-cooperation guarantee

By sending us your money, you buy the service we provide. Check out our terms and conditions if you prefer business talks to be laid out in official language.

Read more

Order your essay today and save 30% with the discount code 30-OFF